ID: 954735644_954735649

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 954735644 954735649
Species Human (GRCh38) Human (GRCh38)
Location 3:52705145-52705167 3:52705187-52705209
Sequence CCACCTGGCTGACGGTAACGGAG ATACACCAGCCTTGAAAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50} {0: 1, 1: 0, 2: 2, 3: 14, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!