ID: 954749544_954749550

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 954749544 954749550
Species Human (GRCh38) Human (GRCh38)
Location 3:52805894-52805916 3:52805913-52805935
Sequence CCACATGTCCCTCCACCGTGGCT GGCTACTCACTCAGCTCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 209} {0: 1, 1: 0, 2: 3, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!