ID: 954792932_954792943

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 954792932 954792943
Species Human (GRCh38) Human (GRCh38)
Location 3:53146285-53146307 3:53146320-53146342
Sequence CCCAAGGGCTCTGGTACCCAGTG TGTGTTTGAATGGCTGGAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!