ID: 954795192_954795197

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 954795192 954795197
Species Human (GRCh38) Human (GRCh38)
Location 3:53157812-53157834 3:53157830-53157852
Sequence CCCACTCTCTCTTGGCCAGGCCA GGCCAGTGCTCTGGGTGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 234} {0: 1, 1: 0, 2: 1, 3: 31, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!