ID: 954795899_954795911

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954795899 954795911
Species Human (GRCh38) Human (GRCh38)
Location 3:53161273-53161295 3:53161303-53161325
Sequence CCGGCGCCCGCCCGCCGCGCGGA GCCACACCTCACTGGCCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 414} {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!