ID: 954806301_954806306

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 954806301 954806306
Species Human (GRCh38) Human (GRCh38)
Location 3:53222849-53222871 3:53222873-53222895
Sequence CCCTTCATGGCAGGACCCAGATC TGCCCTACACACACCCATCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!