ID: 954842733_954842744

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 954842733 954842744
Species Human (GRCh38) Human (GRCh38)
Location 3:53526201-53526223 3:53526239-53526261
Sequence CCAGGTCATGTGCGTCACCCCTC CAACTCTACCCTAAGTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 129} {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!