ID: 954856996_954857004

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 954856996 954857004
Species Human (GRCh38) Human (GRCh38)
Location 3:53652657-53652679 3:53652701-53652723
Sequence CCACAGGGCCACTGGTAGTAGTG GGCTGGCAAACTGTGGCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193} {0: 1, 1: 0, 2: 21, 3: 82, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!