ID: 954860847_954860854

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 954860847 954860854
Species Human (GRCh38) Human (GRCh38)
Location 3:53689232-53689254 3:53689266-53689288
Sequence CCTGCCTGTCGGAACCAGTGAGT GCTGCCAGGGTGCTCCGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79} {0: 1, 1: 0, 2: 0, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!