ID: 954865138_954865146

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954865138 954865146
Species Human (GRCh38) Human (GRCh38)
Location 3:53722673-53722695 3:53722719-53722741
Sequence CCACTTAATGCCAAGCATCTAAT GGACCAAGAATTCTTGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106} {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!