ID: 954869954_954869959

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 954869954 954869959
Species Human (GRCh38) Human (GRCh38)
Location 3:53760261-53760283 3:53760313-53760335
Sequence CCTACTCCAGCTGTTAGGACAGT AAAAGGCTGTGGTTCTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} {0: 1, 1: 0, 2: 3, 3: 13, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!