ID: 954878829_954878839

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 954878829 954878839
Species Human (GRCh38) Human (GRCh38)
Location 3:53820510-53820532 3:53820561-53820583
Sequence CCTTCCGCAGGGGCTTCTGTGCT CCTGCTGAATGTAGATCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 208} {0: 1, 1: 0, 2: 11, 3: 128, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!