ID: 954914457_954914461

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954914457 954914461
Species Human (GRCh38) Human (GRCh38)
Location 3:54136898-54136920 3:54136925-54136947
Sequence CCACGCTTTGAGAGACACTGTTT GTTGTCTCTGGGAAGGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 372} {0: 1, 1: 0, 2: 4, 3: 22, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!