ID: 954938016_954938020

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954938016 954938020
Species Human (GRCh38) Human (GRCh38)
Location 3:54344724-54344746 3:54344754-54344776
Sequence CCAGCTGTCAGAGGTGTGTGAAC CTCCATCTTAATTAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 22, 3: 79, 4: 223} {0: 1, 1: 99, 2: 382, 3: 770, 4: 777}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!