ID: 954943240_954943247

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 954943240 954943247
Species Human (GRCh38) Human (GRCh38)
Location 3:54393953-54393975 3:54394004-54394026
Sequence CCATTTTGGGTACCTTGTTGCTG GCTTCTGTGTCTCACCATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 171} {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!