ID: 954952823_954952838

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 954952823 954952838
Species Human (GRCh38) Human (GRCh38)
Location 3:54490322-54490344 3:54490375-54490397
Sequence CCATCCCTGCGCAGCAGCAGGCT GCCGGTTCCCGCTTCATGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 309} {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!