ID: 954960746_954960752

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954960746 954960752
Species Human (GRCh38) Human (GRCh38)
Location 3:54562711-54562733 3:54562738-54562760
Sequence CCAGTATCTGCCAAGCAGCGTGG CCAGGAATTTTATTTCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86} {0: 1, 1: 0, 2: 2, 3: 29, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!