ID: 954967969_954967970

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954967969 954967970
Species Human (GRCh38) Human (GRCh38)
Location 3:54627598-54627620 3:54627635-54627657
Sequence CCATGAATATTGAAGGTAAGTTT TCTTATGTTTTGAATGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277} {0: 1, 1: 0, 2: 1, 3: 30, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!