ID: 954994501_954994507

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 954994501 954994507
Species Human (GRCh38) Human (GRCh38)
Location 3:54869317-54869339 3:54869355-54869377
Sequence CCTGTTTTCCCAAATGCATTATG TTAAAGAAGCAGAATTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 292} {0: 1, 1: 0, 2: 1, 3: 49, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!