ID: 954999991_955000001

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 954999991 955000001
Species Human (GRCh38) Human (GRCh38)
Location 3:54918737-54918759 3:54918779-54918801
Sequence CCACACCGTGGGCAGAGCCGGGC CTGGATCAGGAGCAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 191} {0: 2, 1: 0, 2: 5, 3: 57, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!