ID: 955012204_955012209

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 955012204 955012209
Species Human (GRCh38) Human (GRCh38)
Location 3:55029084-55029106 3:55029126-55029148
Sequence CCACAAGTCTTTAGACTGTTCTC TTTCTACCAAGTGAGGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 142} {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!