ID: 955025967_955025972

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 955025967 955025972
Species Human (GRCh38) Human (GRCh38)
Location 3:55167784-55167806 3:55167833-55167855
Sequence CCTCTCTATCTGGAGGTGTATCT GCAGCTGGGACAAGGCCAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!