ID: 955040124_955040134

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 955040124 955040134
Species Human (GRCh38) Human (GRCh38)
Location 3:55308334-55308356 3:55308377-55308399
Sequence CCTTGCAAAGTTCCCACCTCTAA AGGTTTTCACAAATGAATTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 83, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!