ID: 955057542_955057545

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 955057542 955057545
Species Human (GRCh38) Human (GRCh38)
Location 3:55470152-55470174 3:55470178-55470200
Sequence CCAGTGGAACTTGCAGTGGCAGC CCGTCTGCACGGTCTTGAACTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 13, 4: 171} {0: 1, 1: 0, 2: 0, 3: 3, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!