ID: 955058036_955058042

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955058036 955058042
Species Human (GRCh38) Human (GRCh38)
Location 3:55473699-55473721 3:55473722-55473744
Sequence CCTCCATCCATCAGGCCTGCTAC CTAATGACATAAAGAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 180} {0: 1, 1: 0, 2: 2, 3: 7, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!