ID: 955058036_955058045

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 955058036 955058045
Species Human (GRCh38) Human (GRCh38)
Location 3:55473699-55473721 3:55473737-55473759
Sequence CCTCCATCCATCAGGCCTGCTAC GAGGCAGGGAGAAAGAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 180} {0: 1, 1: 5, 2: 53, 3: 524, 4: 3710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!