ID: 955059592_955059601

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 955059592 955059601
Species Human (GRCh38) Human (GRCh38)
Location 3:55483944-55483966 3:55483994-55484016
Sequence CCTCCTCCGCAGGCAGTCCCTTA GATCCTCTCCCCTCGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150} {0: 1, 1: 3, 2: 11, 3: 148, 4: 1158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!