ID: 955078960_955078965

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 955078960 955078965
Species Human (GRCh38) Human (GRCh38)
Location 3:55640145-55640167 3:55640171-55640193
Sequence CCACACCCTTGCCTTGATTTTCT ATCCTCTTTGGTAACTAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 502} {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!