ID: 955085228_955085237

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 955085228 955085237
Species Human (GRCh38) Human (GRCh38)
Location 3:55696322-55696344 3:55696358-55696380
Sequence CCTTCTTCCATAAGTCATTGTTG GGCCACAGGAAGGCCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177} {0: 1, 1: 0, 2: 14, 3: 148, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!