ID: 955106441_955106446

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 955106441 955106446
Species Human (GRCh38) Human (GRCh38)
Location 3:55903088-55903110 3:55903133-55903155
Sequence CCAGATTGTACCATTTATATTCA CAAATACCTGTATCATGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 274} {0: 1, 1: 0, 2: 2, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!