ID: 955118991_955118995

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 955118991 955118995
Species Human (GRCh38) Human (GRCh38)
Location 3:56036751-56036773 3:56036786-56036808
Sequence CCTGTACAACCTGCAAATCAGGA AGCCCATGCCACCAGAGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 259} {0: 1, 1: 4, 2: 67, 3: 158, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!