ID: 955121548_955121552

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 955121548 955121552
Species Human (GRCh38) Human (GRCh38)
Location 3:56064753-56064775 3:56064798-56064820
Sequence CCTAGAGGCTGTAAGAACTTGTG CTGCAGCCCATGGGCCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 198} {0: 1, 1: 0, 2: 2, 3: 19, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!