ID: 955195516_955195526

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 955195516 955195526
Species Human (GRCh38) Human (GRCh38)
Location 3:56801882-56801904 3:56801930-56801952
Sequence CCACGATGCCGGGCGGCGGCGGC TAGCCGGGCAGGACTCGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 246} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!