ID: 955199522_955199527

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 955199522 955199527
Species Human (GRCh38) Human (GRCh38)
Location 3:56837819-56837841 3:56837848-56837870
Sequence CCTGTGCCATCATGTGCACACAG GAACAACATGCTAGAACGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 169} {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!