ID: 955213081_955213087

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 955213081 955213087
Species Human (GRCh38) Human (GRCh38)
Location 3:56960274-56960296 3:56960326-56960348
Sequence CCCATTTTATAGATAAGAGCACT CTGATCACACAGATGAAATTGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 94, 3: 732, 4: 3248} {0: 1, 1: 0, 2: 3, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!