ID: 955249838_955249847

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 955249838 955249847
Species Human (GRCh38) Human (GRCh38)
Location 3:57269154-57269176 3:57269184-57269206
Sequence CCTGATTTAGCAAAGATGAATTG ATGGAGAAAAGGGCTGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 278} {0: 1, 1: 0, 2: 6, 3: 75, 4: 725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!