ID: 955260713_955260717

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 955260713 955260717
Species Human (GRCh38) Human (GRCh38)
Location 3:57387623-57387645 3:57387648-57387670
Sequence CCCAGCTAAAAGACTAAATCTCC GACTCCCTTGGAATTCAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 192} {0: 1, 1: 0, 2: 0, 3: 18, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!