|
Left Crispr |
Right Crispr |
| Crispr ID |
955267831 |
955267832 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:57464282-57464304
|
3:57464298-57464320
|
| Sequence |
CCAAATCAGAGTGGCTATTCTGC |
ATTCTGCAGCACCACACTGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 33, 3: 86, 4: 180} |
{0: 1, 1: 3, 2: 11, 3: 46, 4: 178} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|