ID: 955303174_955303179

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 955303174 955303179
Species Human (GRCh38) Human (GRCh38)
Location 3:57803658-57803680 3:57803698-57803720
Sequence CCTTCCTCTCCACTCTCTTTTTG CTGGAGGCACAAATCCAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 115, 4: 1084} {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!