ID: 955336249_955336256

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 955336249 955336256
Species Human (GRCh38) Human (GRCh38)
Location 3:58088657-58088679 3:58088676-58088698
Sequence CCAACAAAAGCTCCCCTGTCCAG CCAGCCAGAAGACCAGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 147} {0: 1, 1: 3, 2: 18, 3: 86, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!