ID: 955339256_955339276

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 955339256 955339276
Species Human (GRCh38) Human (GRCh38)
Location 3:58112312-58112334 3:58112364-58112386
Sequence CCAACAGGTAGGGTCCTTCTCCC CTTTCTATGCAGTCGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!