ID: 955347275_955347282

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 955347275 955347282
Species Human (GRCh38) Human (GRCh38)
Location 3:58170454-58170476 3:58170480-58170502
Sequence CCCACCTCTTAGGGGCCCCAGCA TCGTGGAAGCACCTTACCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 175} {0: 1, 1: 0, 2: 1, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!