ID: 955353488_955353498

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 955353488 955353498
Species Human (GRCh38) Human (GRCh38)
Location 3:58211159-58211181 3:58211210-58211232
Sequence CCTCATTTAGGCGCCATCCTCCA CAGCTCTGACATCTAGTCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} {0: 1, 1: 0, 2: 0, 3: 3, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!