ID: 955374112_955374117

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 955374112 955374117
Species Human (GRCh38) Human (GRCh38)
Location 3:58379840-58379862 3:58379861-58379883
Sequence CCCAGCTACAGGTGTGTACCACT CTTGTAGAGGCTGAGGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 132} {0: 1, 1: 0, 2: 7, 3: 244, 4: 4537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!