ID: 955374112_955374120

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 955374112 955374120
Species Human (GRCh38) Human (GRCh38)
Location 3:58379840-58379862 3:58379886-58379908
Sequence CCCAGCTACAGGTGTGTACCACT TGCTTGAGCTTAGGAGGTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 132} {0: 4, 1: 176, 2: 2208, 3: 13205, 4: 50105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!