ID: 955375832_955375835

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 955375832 955375835
Species Human (GRCh38) Human (GRCh38)
Location 3:58396431-58396453 3:58396450-58396472
Sequence CCACTTGCCTATCACTGCTCTAG CTAGTTCACCAGGACATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197} {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!