ID: 955393337_955393343

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 955393337 955393343
Species Human (GRCh38) Human (GRCh38)
Location 3:58536901-58536923 3:58536920-58536942
Sequence CCATCTCCCTGCTACTAACACAG ACAGAAACTGCAAGAGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 274} {0: 1, 1: 0, 2: 3, 3: 42, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!