ID: 955403654_955403662

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 955403654 955403662
Species Human (GRCh38) Human (GRCh38)
Location 3:58611361-58611383 3:58611394-58611416
Sequence CCAGAGAGGGTGTCATTATGAAC GTCACTGGTGTGGCTTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111} {0: 1, 1: 0, 2: 4, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!