ID: 955414916_955414921

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 955414916 955414921
Species Human (GRCh38) Human (GRCh38)
Location 3:58683260-58683282 3:58683312-58683334
Sequence CCAAGTTTACACCCTAGGGAGTA GAACCACAAGTGCCACAAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!