ID: 955424682_955424688

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 955424682 955424688
Species Human (GRCh38) Human (GRCh38)
Location 3:58776036-58776058 3:58776061-58776083
Sequence CCAGCCTTCCTCTCCCTTTTCTG AACTTGGCGCTTCTTTCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 185, 4: 1359} {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!